SciELO - Scientific Electronic Library Online

 
vol.42 número3Comportamiento de la mastitis bovina en hatos lecheros del sector campesino de la provincia Villa Clara, CubaDetección de Streptococcus agalactiae a partir de muestras de leche cruda índice de autoresíndice de materiabúsqueda de artículos
Home Pagelista alfabética de revistas  

Servicios Personalizados

Articulo

Indicadores

  • No hay articulos citadosCitado por SciELO

Links relacionados

  • No hay articulos similaresSimilares en SciELO

Compartir


Revista de Salud Animal

versión On-line ISSN 2224-4700

Rev Salud Anim. vol.42 no.3 La Habana sept.-dic. 2020  Epub 01-Dic-2020

 

Short Communication

Anaplasma platys in dog and Rhipicephalus sanguineus in the city of Salta in Salta Province, Argentina

Anaplasma platys en perro y en Rhipicephalus sanguineus en la ciudad de Salta, Provincia Salta, Argentina

0000-0003-2045-8716Matheus Dias Cordeiro1  , 0000-0001-7222-2030Thays Figueiroa1  , 0000-0002-9281-9456Gabriela Beatriz Trova2  , 0000-0002-5471-2404Izabela Mesquita Araujo1  , 0000-0003-1173-8601Jaqueline Rodrigues de Almeida Valim1  , 0000-0002-2864-0849Cintia Raquel Ramos2  , 0000-0002-0181-2575Natalia Ricci2  , 0000-0002-5834-141XAdivaldo Henrique da Fonseca1  * 

1Universidade Federal Rural do Rio de Janeiro - UFRRJ, Seropédica, Br 465, km 7, Seropédica, Rio de Janeiro 23891-000, Brazil.

2Universidade Católica de Salta, Campus Castañares, Salta, Argentina

ABSTRACT

A dog with 32 specimens of Rhipicephalus sanguineus sensu lato were examined at the DNA level to determine the presence of Borrelia spp., Anaplasma platys, Ehrlichia spp., and Babesia spp. A partial sequence of A. platys gene gltA (689 bp) was detected in the dog’s blood and three ticks (9.37 %). This is the first detection of A. platys in a young dog with symptoms and an animal’s R. sanguineus s.l. ticks in the city of Salta in northwest Argentina.

Key words: Anaplasma; hemoparasites ticks; Canis familiaris; Argentina

RESUMEN

Se examinó un perro con 32 especímenes de Rhipicephalus sanguineus sensu lato a nivel de ADN, para determinar la presencia de Borrelia spp., Anaplasma platys, Ehrlichia spp. y Babesia spp. Se detectó una secuencia parcial del gen gltA (689 pb) de A. platys en la sangre del perro y en tres garrapatas (9,37 %). Esta es la primera detección de A. platys en animales jóvenes y enfermos y en R. sanguineus s.l y garrapatas en la ciudad de Salta, en el noroeste de Argentina.

Palabras-clave: Anaplasma; hemoparasitos; garrapatas; Canis familiaris; Argentina

INTRODUCTION

Infectious diseases are the leading cause of death among dogs (1) and a simultaneous occurrence of more than one disease is common, especially in weakened dogs. Although in clinical practice, diagnosis is usually based on the progress of clinical signs and laboratory findings, many illnesses offer generic signs, such as apathy, anorexia and occasionally fever, progressing to respiratory, gastrointestinal, and neurological manifestations (2,3).

Organisms of the Anaplasmataceae family, Rickettsiales order, are Gram-negative bacteria and obligate intracellular parasites. Anaplasma platys is the etiological agent of canine cyclic thrombocytopenia (CCT). This agent affects circulating platelets, in which it is possible to observe morulae, particularly in the acute phase of the disease (4). The severity of thrombocytopenia and percentage of parasitized thrombocytes are higher during primary infection, which lasts 10 to 14 days (5). CCT is usually asymptomatic or subclinical and difficult to differentiate from other diseases (6,7). Anaplasma platys has been reported to infect other hosts, such as humans (8-11) and cats (12).

Anaplasma platys is predominant in tropical regions, concurring with Ehrlichia canis and the distribution of Rhipicephalus sanguineus sensu lato (13). Additionally, Brandão et al. (14) confirmed the relevance of the degree of infestation in stray dogs, compared to pet dogs, with respect to the degree of infestation by R. sanguineus s.l. and the risk of being carriers of A. platys. On a related note, Cicuttin et al. (15) discussed the vectorial capacity of R. sanguineus s.l. confirming the species as a competent transmitter for Ehrlichia canis and A. platys.

Oscherov et al. (16) noted the first detection of Anaplasmataceae family organisms in the Argentine territory when the authors discovered the natural infection in R. sanguineus s.l. in the city of Corrientes in northeast Argentina. Later, Eiras et al. (17) reported a co-infection with Hepatozoon canis, Babesia vogeli and A. platys in dogs in the province of Buenos Aires, as well. Considering the scarcity of studies on agents of the Anaplasmataceae family in Argentina and the relevance of this subject to South America, the objective of the present study was to report the molecular detection of an animal naturally infected by A. platys along with its ticks in Salta, Salta Province, Argentina.

MATERIAL AND METHODS

In November 2018, a six-month-old Dachshund was admitted into the Catholic University of Salta Veterinary Hospital to receive clinical care, exhibiting a clinical condition of gastroenteritis. Upon admission, anamnesis was performed, and gastroenteritis, prostration and dehydration were observed. The animal was quickly sent to serotherapy (0.9 % NaCl) for intravenous rehydration.

Blood was collected in a vacuum tube with and without ethylenediaminetetraacetic acid (EDTA) anticoagulant by puncture of the cephalic vein. A drop of blood was used for the rapid test for the detection of E. canis antibodies employing a chromatographic membrane (Speed EhrliTM Virbac®), following the manufacturer’s operating instructions.

During clinical examination, ectoparasites were collected with tweezers or manually and they preserved in polypropylene tubes containing isopropyl alcohol. The taxonomic identification of ectoparasites was carried out through the dichotomous keys of Barros-Battesti et al. (18) for ticks and Linardi and Guimarães (19) for fleas.

Blood DNA extraction was carried out with a DNeasy Blood & Tissue Kit® (Qiagen, Hilden, NRW, Germany), according to the manufacturer’s instruction. The DNA extraction of ectoparasites was performed by the phenol chloroform technique described by McIntosh et al. (20). The extracted DNA was submitted to PCR to detect the DNA of Borrelia spp., A. platys, Ehrlichia spp. and Babesia spp., using primers with their respective protocols, as shown in Table 1.

Table 1 List of the primers used for PCR to detect the DNA of Borrelia spp., A. platys, Ehrlichia spp., and Babesia spp., from dog’s blood and ticks from Salta City, Argentina./ Lista de los cebadores utilizados para la PCR para detectar el ADN de Borrelia spp., A. platys, Ehrlichia spp. y Babesia spp., a partir de sangre de perro y garrapatas de la ciudad de Salta, Argentina

Primers Gene Organism Nucleotide sequences (5’-3’) Expected Amplicon length References
BorFlaF1 flaB Borrelia spp. TACATCAGCTATTAATGCTTCAAGAA 740 pb Blanco et al.(21)
BorFlaR1 GCAATCATWGCCATTGCRGATTG
BorFlaF2 CTGATGATGCTGCTGGWATGG
BorFlaR2 TCATCTGTCATTRTWGCATCTT
BT-F3 18S rRNA Ordem Piroplasmida TGGGGGGAGTATGGTCGCAAG 650 pb Seo et al.(22)
BT-R3 CTCCTTCCTTTAAGTGATAAG
DSB-330 Dsb Ehrlichia spp. GATGATGCTTGAAGATATSAAACAAAT 349 bp Almeida et al. (23)
DSB-380 ATTTTTAGRGATTTTCCAATACTTGG
DSB-720 CTATTTTACTTCTTAAAGTTGATAWATC
Platys689F gltA Anaplasma platys ATGCTGTTTTGATGTGCGGG 689 bp This study
Platys69R CCGCACGGTCGCTGTT da Silva et al.(24)

The products amplified by PCR were purified based on ExoSAP-IT® (Affymetrix USB®) according to the manufacturer’s recommendation. After purification, DNA was sequenced using a capillary-type Sanger platform on a DNA analyzer ABI 3730 (Applied Biosystems, Life Technologies®). The resulting sequences were compared to those published utilizing the platform, NCBI Nucleotide BLAST.

According to clinical examination, the animal exhibited depletion, loss of appetite and dehydration levels of approximately 10 %. It also evidenced eyeball retraction, pale mucosae, dyspnea, 32°C (89.6ºF) temperature, diarrhea, and generalized petechiae. The tutor reported that the animal had already been assisted by other veterinary clinics, being under treatment with Ranitidine, Tramadol and Sucralfate.

The vaccine protocol for distemper and parvovirus viruses was incomplete. Six hours after service arrival, the animal died. No technique for diagnosing viral disease was attempted despite the fact that the presumptive diagnosis was gastroenteritis caused by the distemper virus.

RESULTS AND DISCUSSION

Thirty-three ectoparasites were collected from the animal and identified according to morphology: 32 ticks (7 larvae, 23 nymphs and 2 adults) of the species R. sanguineus s.l. and 1 flea of the species Ctenocephalides canis.

PCR was applied to analyze the extracted DNA of all ectoparasites along with blood samples. Although an evaluation by the PCR technique to determine the presence of agents transmitted by ticks showed a negative result for Ehrlichia spp., the quick testing using Speed EhrliTM® had presented positive results for the E. canis species. Furthermore, when the materials were tested for A. platys gene gltA, both the animal’s blood and 3 ticks (3/32) amplified the sequence. The partial sequences of the gltA gene for A. platys were submitted to the GenBank under the accession numbers, MN725733 (Blood) and MN725734 (Ticks). Those sequences were compared with others deposited in the GenBank and yielded an identity of 100 %, 99.68 % and 99.56 % with A. platys (KP903286), (KR011928) and (KP903289), respectively.

The present study refers to a dog infected with A. platys exhibiting classic symptoms of CCT (Petechiae) as represented by anorexia, fever, anemia, apathy, and petechiae. To date, few occurrences of clinical infection by A. platys in dogs in Argentina have been reported (13,15,25). This is the first report of A. platys causing symptoms in a dog in the Argentine territory; that said, it is a likely case of co-infection with the distemper virus, which may have led to the animal’s death. The literature offers no records regarding gastroenteritis caused by A. platys.

In the present study, serology was positive for E. canis though negative by PCR. Considering the animal’s young age, it can be concluded that maternal antibodies were still present as acute infection increased the chance of detection by molecular techniques as demonstrated by Almeida et al. (26). However, it was not possible to discard cross-reactions between A. platys and E. canis as the manufacturer did not mention tests demonstrating the absence of that possibility.

In the present study, A. platys was also detected in three R. sanguineus s.l. ticks out of the total number of specimens found parasitizing the animal under consideration. The presence of A. platys in Argentina is a ubiquitous phenomenon in both tropical and temperate lineages of R. sanguineus s.l (15). Additionally, the presence of A. platys in ticks collected from positive dogs indicates their ability to ingest the bacterium during a blood meal, possibly in relation to the level of rickettsia of dogs as evidenced by Breitschwerdt et al. (27).

Furthermore, ticks belonging to this group are competent vectors for many other pathogens to dogs, including phylogenetically related bacteria, such as E. canis (7,8). Otherwise, the failure in demonstrating the vector competence of R. sanguineus for A. platys in the study of Simpson et al.(25) may be related to the tick strain or species used by the researchers.

This is the first molecular record on the presence of A. platys in association with distemper in the northwest region of Argentina. This result indicates that CCT caused by A. platys, together with the results generated by Cicuttin et al. (15), may be endemic in the region. As several studies have demonstrated, even though A. platys is considered less pathogenic than other agents of the Anaplasmataceae family, its importance in terms of zoonoses should not be underestimated (8,10,11).

ACKNOWLEDGMENT

The authors like to express their gratitude to the Conselho Nacional de Desenvolvimento Científico e Tecnológico - CNPq (A.H.F. 305480/2013-8), Coordenação de Apoio ao Aperfeiçoamento de Pessoal de Nível Superior - CAPES, and Consejo de Investigaciones de la Universidad Catolica de Salta, for their financial support.

REFERENCES

1.  Bentubo HDL, Tomaz MA, Bondan EF, Lallo MA. Expectativa de vida e causas de morte em cães na área metropolitana de São Paulo (Brasil). Ciênc Rural. 2007; 37(4):1021-1026. [ Links ]

2.  Greene CE. Infectious diseases of the dog and cat. 4th ed. Vol. 1. 2013: Elsevier Health Sciences. 1376. [ Links ]

3.  Harrus S, Waner T. Diagnosis of canine monocytotropic ehrlichiosis (Ehrlichia canis):3.  An overview.Vet J. 2011;187(3):292-296. [ Links ]

4.  Tateishi V, Lí O, Hoyos L, Rivera H, Manchego A, Barrios L, et al4.  . Identificación hematológica y molecular de Anaplasma platys4.  en en caninos domésticos de Lima Metropolitana con signos clínicos compatibles con anaplasmosis. Rev Invest Vet Perú. 2015;26(1):111-118. [ Links ]

5.  Baker DC, Simpson M, Gaunt SD,Corstvet RE. Acute Ehrlichia platys5.  Infection in the Dog. Vet Pathol. 1987;24(5):449-453. [ Links ]

6.  Bouzouraa T, René-Martellet M, Chêne J, Attipa C, Lebert I, Chalvet-Monfray K, et al6.  . Clinical and laboratory features of canine Anaplasma platys6.  infection in 32 naturally infected dogs in the Mediterranean basin. Ticks Tick Borne Dis. 2016;7(6):1256-1264. [ Links ]

7.  Dantas-Torres F. Canine vector- borne diseases in Brazil. Parasit Vectors. 2008;1:1-25. [ Links ]

8.  Abarca K, López Del J, González P, Dabanch J, Torres M, Solari V, et al8.  . Evidencia seroepidemiológica de exposición humana a Anaplasma sp8.  en Santiago, Chile. Rev Chil Infectol. 2008;25(5):358-361. [ Links ]

9.  Tamí I del C de, Tamí-Maury IM. Morphologic identification of Ehrlichia9.  sp. in the platelets of patients infected with the human immunodeficiency virus in Venezuela. Rev Panam Salud Pública. 2004;16(5):345-349. [ Links ]

10.  Arraga-Alvarado C, Palmar M, Parra O, Salas P. Ehrlichia platys10.  (Anaplasma platys10.  ) in Dogs from Maracaibo, Venezuela: An Ultrastructural Study of Experimental and Natural Infections. Vet Pathol . 2003;40(2):149-156. [ Links ]

11.  Maggi RG, Mascarelli PE, Havenga LN, Naidoo V, Breitschwerdt EB. Co-infection with Anaplasma platys11.  , Bartonella henselae11.  and Candidatus Mycoplasma haematoparvum11.  in a veterinarian. Parasit Vect. 2013;6(1):103. [ Links ]

12.  Lima MLF, Soares PT, Ramos CAN, Araújo FR, Ramos RAN, Souza IIF, et al12.  . Molecular detection of Anaplasma platys12.  in a naturally-infected cat in Brazil. Braz J Microbiol. 2010;41:381-385. [ Links ]

13.  Pérez-Macchi S, Pedrozo R, Bittencourt P, Müller A. Prevalence, molecular characterization and risk factor analysis of Ehrlichia canis13.  and Anaplasma platys i13.  n domestic dogs from Paraguay. Comp Immunol Microbiol Infe Dis. 2019;62:31-39. [ Links ]

14.  Brandão VMD, Barrozo PHM, Sousa LO, Santos RCd, Schwanke K, Sampaio Junior FD, et al14.  . Molecular detection of Ehrlichia canis14.  and Anaplasma platys14.  in dogs from municipality of Belém, State of Pará, Brazil. Ciênc Rural . 2019;49. [ Links ]

15.  Cicuttin GL, Tarragona EL, De Salvo MN, Mangold AJ, S Nava. Infection with Ehrlichia canis15.  and Anaplasma platys15.  (Rickettsiales: Anaplasmataceae) in two lineages of Rhipicephalus sanguineus15.  sensu lato (Acari: Ixodidae) from Argentina. Ticks Tick Borne Dis . 2015;6(6):724-729. [ Links ]

16.  Oscherov E, Milano A, Lobo B, Anda P, Escudero R. Detection of Anaplasma platys16.  and other pathogens in ectoparasites from urban hosts in Northeast Argentine. Rev Ibero-Latinoam Parasitol. 2011;70(1):42-48. [ Links ]

17.  Eiras DF, Craviotto MB, Vezzani D, Eyal O, Baneth G. First description of natural Ehrlichia canis17.  and Anaplasma platys17.  infections in dogs from Argentina. Comp Immunol Microbiol Infect Dis. 2013;36(2):169-173. [ Links ]

18.  Barros-Battesti DM, Arzua M, Bechara GH. Carrapatos de importância médico-veterinária da região neotropical: um guia ilustrado para identificação de espécies. 2006, 1a18.  ed. São Paulo: Vox/ICTTD-3/Butantan. [ Links ]

19.  Linardi PMLR. Guimarães, Siphonaptera of Brazil. Museu de Zoologia, Universidade de São Paulo. 2000. [ Links ]

20.  McIntosh D, Bezerra RA, Luz HR, Faccini JLH, Gaiotto FA, Giné GAF, et al20.  . Detection of Rickettsia bellii20.  and Rickettsia amblyommii20.  in Amblyomma longirostre20.  (Acari: Ixodidae) from Bahia state, Northeast Brazil.Brazil J Microbiol. 2015;46(3):879-883. [ Links ]

21.  Blanco CM, Teixeira BR, da Silva AG, de Oliveira RC, Strecht L, Ogrzewalska M, et al21.  . Microorganisms in ticks (Acari: Ixodidae) collected on marsupials and rodents from Santa Catarina, Paraná and Mato Grosso do Sul states, Brazil. Ticks Tick Borne Dis . 2017;8(1):90-98. [ Links ]

22.  Seo M-G, Yun S-H, Choi S-K, Cho G-J, Park Y-S, Cho K-H, et al22.  . Molecular and phylogenetic analysis of equine piroplasms in the Republic of Korea .Res Vet Sci. 2013;94(3):579-583. [ Links ]

23.  Almeida AP, Souza TD, Marcili A, Labruna MB. Novel Ehrlichia23.  and Hepatozoon23.  agents infecting the crab-eating fox (Cerdocyon thous23.  ) in southeastern Brazil. J Med Entomol. 2013;50(3):640-646. [ Links ]

24.  da Silva CB, Pires MS, Vilela JA, Peckle M, da Costa RL, Vitari GL, et al24.  . A new quantitative PCR method for the detection of Anaplasma platys24.  in dogs based on the citrate synthase gene. J Vet Diag. Invest. 2016;28(5):529-535. [ Links ]

25.  Cicuttin GL, Vidal P, Nazarena De Salvo M, Beltrán FJ, Gury Dohmen FE. Detección molecular de Rickettsia massiliae25.  y Anaplasma platys25.  en garrapatas Rhipicephalus sanguineus25.  y caninos domésticos del municipio de Bahía Blanca (Argentina). Rev Chil Infectol . 2014;31:563-568. [ Links ]

26.  Almeida AB, Paula DA, DutraV, Nakazato L, Mendonça AJ , Sousa VR. Infecção por Ehrlichia canis26.  e Anaplasma platys26.  em cadelas e neonatos de Cuiabá, Mato Grosso. Arch Vet Sci. 2010;15(3):127-134. [ Links ]

27.  Breitschwerdt EB, Hegarty BC, Qurollo BA, Saito TB, Maggi RG, Blanton LS, et al27.  . Intravascular persistence of Anaplasma platys27.  , Ehrlichia chaffeensis27.  , and Ehrlichia ewingii27.  DNA in the blood of a dog and two family members. Parasit Vectors . 2014;7(1):298. [ Links ]

28.  Dantas-Torres F, Latrofa MS, Annoscia G, Giannelli A, Parisi A, Otranto D. Morphological and genetic diversity of Rhipicephalus sanguineus sensu lato28.  from the New and Old Worlds. Parasit Vectors . 2013;6:213. https://doi.org/10.1186/1756-3305-6-213Links ]

29.  Simpson RM, Gaunt SD, Hair JA, Kocan KM, Henk WG, Casey HW. Evaluation of Rhipicephalus sanguineus29.  as a potential biologic vector of Ehrlichia platys29.  . Am J Vet Res. 1991;52(9):1537-1541. [ Links ]

1Ethical Statement: All procedures involving animals were evaluated and approved by the Ethical Principles of Animal Experimentation established by the Committee of Ethical of Animal Experimentation of the Universidad Catholica de Salta, Argentina.

Received: June 13, 2020; Accepted: September 22, 2020

*Corresponding author: Adivaldo Henrique da Fonseca. E-mail: adivaldofonseca@yahoo.com

Conflict of interest: The authors declare no conflicts of interest

Authors´ contribution: Matheus Dias Cordeiro: conceptualization, data collection and draft original writing. Thays Figueiroa: contributed to the experimental laboratory work and reviewed the article. Gabriela Beatriz Trova: performed the experimental work involving animals and contributed to the editing of the article. Izabela Mesquita Araujo: contributed to the experimental laboratory work and reviewed the article. Jaqueline R. de Almeida Valim: contributed to the experimental laboratory work and reviewed the article. Cintia Raquel Ramos: performed the experimental work involving animals and contributed to the editing of the article. Natalia Ricci: performed experimental work involving animals and contributed to the editing of the article. All authors read and approved the final version of the article. Adivaldo Henrique da Fonseca: conceptualization, critical review and editing.

Creative Commons License