SciELO - Scientific Electronic Library Online

 
vol.57 número1Desarrollo de un ELISA novedoso para el serodiagnóstico de Leptospirosis y la detección adicional de Leptospira patogénica mediante la reacción en cadena de la polimerasa para diagnóstico veterinario de rutinaSolubilización de componentes de membrana externa de Leptospira interrogans serovar mozdok mediante desoxicolato de sodio y tritón X-100 y evaluación de su capacidad inmunogénica y protección homóloga y heteróloga inducida en hamsters índice de autoresíndice de assuntospesquisa de artigos
Home Pagelista alfabética de periódicos  

Serviços Personalizados

Artigo

Indicadores

  • Não possue artigos citadosCitado por SciELO

Links relacionados

  • Não possue artigos similaresSimilares em SciELO

Compartilhar


Revista Cubana de Medicina Tropical

versão On-line ISSN 1561-3054

Rev Cubana Med Trop v.57 n.1 Ciudad de la Habana jan.-abr. 2005

 

Índice Anterior Siguiente
REV CUBANA MED TROP 2005;57(1):51-2

Formato PDF

Istituto Zooprofilattico Sperimentale della Sicilia “A. Mirri” Palermo, Italy

Comparison of different DNA extraction and polymerase chain reaction methods to detect Leptospira spp. on field samples

Dr. Maria Vitale,1 Dr. Fabrizio Vitale,2 Dr. Stefano Reale,3 Dr. Gesualdo Vesco,3 Dr. Vittoria Currò2 y Dr. Santo Caracappa2

Summary

It was carried out a comparison on two reference Leptospira strains DNA between different extraction methods and two polymerase chain reaction protocol. The DNA was quantified and serial dilutions were tested by polymerase chain reaction. The results showed difference in terms of recovery and sensitivity between this methods.

Key words: Leptospira, DNA extraction, PCR.

 

In Italy leptospirosis is diffused in the northern regions but only very limited serological survey had been conducted until now in Sicily. To obtain more data on animal leptospirosis in Sicily we decided to begin a general survey on herds and wild animals, not only by serological methods (MAT) but also by molecular biology technique. To choose for a high sensitive and specific method we performed comparison on two reference Leptospira strains DNA between different extraction methods and two PCR protocol.

L. pomona and L. sejoroe reference strains were kindly provided by the Italian animal leptospirosis reference centre in IZS of Brescia.

Leptospira cells were counted on a Burker chamber and serial dilution were performed up to 50 cells/100 microliters. The suspension was introduced with a syringe in 25 mg of negative bovine Kidney samples and DNA extraction had been performed by the following methods:

A) Proteinase K treatment followed by phenol-chloroform extraction.
B) Quiagen column affinity following manufacture extraction.
C) Rybolyser homogenization followed by affinity column.

The DNA was quantified and serial dilutions were tested by PCR.

Two PCR method were used for sensitivity assay targeting fla B gene (primers flaB-Forward -TCTCACCGTTCTCTAAAGTTCAAC and flaB-Reverse CTGAATTCGGTTTCATATTTGCC with an amplicon of 793bp1 and 16S rRNA gene (primers: LEPTO E1 GGGAAAAATAAGCAGCGATGTGand LEPTO E2-ATTCCACTCCATGTCAAGCC amplicon 571 bp).2

The analysis, performed in double, showed that not much difference in terms of recovery and sensitivity are present between the methods A and B but method C gives a higher sensitivity probably due to a better lysis and a more efficient proteinase K digestion.

DNA extracted by homogenization with ribolyser showed a sensitivity of up to 5 cell with flaB PCR but a further 5 fold dilution could be detected by 16 ribosomal RNA gene PCR.

 

Comparación de diferentes métodos de extracción de ADN y reacción de polimerasa en cadena para detectar Leptospira spp. en muestras de campo

Resumen

Se realizó una comparación entre diferentes métodos de extracción y 2 protocolos de reacción en cadena de la polimerasa en 2 ADN de cepas de Leptospira de referencia. El ADN se cuantificó y se probaron diluciones seriadas mediante la reacción en cadena de la polimerasa. Los resultados mostraron diferencias en términos de recuperación y sensibilidad entre estos métodos.

Palabras clave: Leptospira, ADN, extracción, RCP.

 

References

  1. Kawabata H, Dancel LA, Vilanueva SYAM, Yanagihara Y, Koizumi N, Watanabe H. -flaB-polymerase chain reaction (flaB-PCR) and its Restriction Fragment Length Polymorphism (RFLP) analysis are an efficient tool for detection and identification of Leptospira spp. Microbiol Immunol 2001;45(6):491-6.
  2. Faber NA, Crawford M, LeFebvre RB, Buyukmihci NC, Madigan JE, Willits NH. Detection of Leptospira spp. in the aqueous humor of horses with naturally acquired recurrent uveitis. J Clin Microbiol 2000;38(7):2731-3.

Recibido: 27 de diciembre de 2004. Aprobado: 10 de marzo de 2005.
Dr. Maria Vitale. Istituto Zooprofilattico Sperimentale della Sicilia “A. Mirri” Palermo, Italy. Fax: 39-0916565313 E-mail: mvitale@pa.izs.it

1 Doctor in Veterinary Medicine. Molecular Biology.
2 Doctor in Veterinary Medicine.
3 Doctor in Biological Sciences.

Índice Anterior Siguiente

Creative Commons License All the contents of this journal, except where otherwise noted, is licensed under a Creative Commons Attribution License