Original Article

Alternative method using Real Time PCR for evaluation of inactivated Newcastle disease viral vaccine

Método alternativo de PCR en tiempo real para la evaluación de la vacuna vírica inactivada contra la enfermedad de Newcastle

0000-0003-1199-1375Mounir El Safty¹  , 0000-0003-2462-956XHala Mahmoud^{1  *}  , 0000-0003-4074-4584Reem A. Soliman¹ 

¹Central Laboratory for Evaluation of Veterinary Biologics, Agriculture Research Center, Egypt.

ABSTRACT

The present work aims to establish a new alternative protocol to evaluate in vitro potency of inactivated Newcastle disease virus vaccine using Real Time PCR. Aqueous phases of seven inactivated Newcastle disease virus vaccines batches of different manufacturers were extracted by isopropyl myristate. The Newcastle disease virus antigen of each vaccine sample was determined by a standard Real Time PCR assay. Vaccines were inoculated into separate groups of 3-week-old specific pathogen free chickens using the recommended dose of vaccine. The immunogenicity was assessed for each vaccine by the Newcastle disease virus hemagglutination inhibition antibody titers. Individual serum samples were collected 4 weeks post vaccination, then vaccine efficacy and protection rates were recorded after challenge test of birds vaccinated with the virulent Newcastle disease virus. There is the possibility of using the Real Time PCR as an in vitro assay for vaccine evaluation. The Cycle Threshold values were ranged between 21.17 and 25.23. On the other hand, the hemagglutination inhibition titers ranged between 7.1 log₂ to 6.2. The comparison between the Cycle Threshold values of the antigen extracts and the corresponding results of challenge test and in vivo hemagglutination inhibition assays using sera of vaccinated birds proved a strong correspondence between the in vitro and in vivo results.

Key words: in vitro; inactivated vaccines; Newcastle disease virus; Real Time PCR; vaccine potency

RESUMEN

El presente trabajo pretende establecer un nuevo protocolo alternativo para la evaluación in vitro de la potencia de la vacuna de virus inactivado contra la enfermedad de Newcastle mediante PCR en tiempo real. Las fases acuosas de siete lotes de vacunas inactivadas contra el virus de la enfermedad de Newcastle de distintos fabricantes se extrajeron mediante miristato de isopropilo. El antígeno del virus de la enfermedad de Newcastle de cada muestra de vacuna se determinó mediante un ensayo estándar de PCR en tiempo real. Las vacunas se inocularon en grupos separados de pollos libres de patógenos específicos de 3 semanas de edad utilizando la dosis recomendada de vacuna. La inmunogenicidad se evaluó para cada vacuna mediante los títulos de anticuerpos de inhibición de la hemaglutinación del virus de la enfermedad de Newcastle. Se recogieron muestras individuales de suero 4 semanas después de la vacunación y, a continuación, se registraron la eficacia de la vacuna y los índices de protección tras la prueba de reto de las aves vacunadas con el virus virulento de la enfermedad de Newcastle. Existe la posibilidad de utilizar la PCR en tiempo real como ensayo in vitro para la evaluación de vacunas. Los valores del umbral de ciclo oscilaron entre 21,17 y 25,23. Por otra parte, los títulos de anticuerpos inhibidores de la hemaglutinación oscilaron entre 7,1 log₂ y 6,2. La comparación entre los valores del umbral de ciclo de los extractos de antígeno con los resultados correspondientes de la prueba de reto y los ensayos de inhibición de la hemaglutinación in vivo, utilizando sueros de aves vacunadas, demostró una fuerte correspondencia entre los resultados in vitro e in vivo.

Palabras-clave: in vitro; vacunas de productos inactivados; virus de la enfermedad de Newcastle; Reacción en Cadena en Tiempo Real de la Polimerasa; potencia de la vacuna

Introduction

Newcastle disease (ND) is an infectious highly contagious disease of poultry. It is caused by the virulent strain of Newcastle disease virus (NDV). In the past, it was known as avian paramyxovirus serotype 1 and characterized mainly by damaging to the central nervous system and digestive tract¹ with high mortality rates. According to the international reports, there were about four fatal outbreaks of ND around the world that caused huge harm to poultry industry and international trade.² NDV is an ancient endemic avian disease in Egypt. The current policy for its control depends on vaccination.²

An in vitro potency method can be used to evaluate the NDV inactivated oil-adjuvant vaccines. The vaccine batch can be judged as approved or rejected according to quantification of the hemagglutinin-neuraminidase (HN) antigen amount per dose in the aqueous phase of the vaccine post extraction by isopropyl myristate (IPM).³

Hundreds of different oil-adjuvant monovalent and combined NDV vaccines are registered annually at Central Laboratory for Evaluation of Veterinary Biologics (CLEVB) to be evaluated for their quality. Routine in-vivo evaluation procedures are applied according to Egyptian Standards Regulations for Evaluation of Veterinary Biologics.⁴ The current standard in vivo method to evaluate NDV vaccines includes vaccination of chickens with the recommended vaccine dose and route, collection of blood samples at 28^th day post vaccination for serological hemagglutination inhibition (HI) testing and challenge test with ND virulent virus.

In vivo methodology for potency testing is time-consuming and not cost-effective. Hence, the establishment and development of new in vitro potency assays for inactivated NDV vaccines is essential to improve the monitoring and approval process of vaccine before release to markets. This target is of high priority to the CLEVB to reduce the time required for vaccines evaluation. The present study illustrates the application of Real Time PCR (RT-PCR) to evaluate NDV vaccine efficacy, by determination of NDV antigen in inactivated vaccines.⁵⁾ The RT-PCR assay is an ideal, simple and fast method with reduced risks of contaminations. Additionally, RT-PCR is more specific and sensitive method.⁶

Material and Methods

Vaccines

Seven different inactivated NDV vaccines batches were selected randomly to vaccinate seven groups of 3-week-old chicks according to Egyptian Standards Regulations.^4,7 The same batches were used for ND antigen recovery technique for further antigen determination quantification. The used vaccines differed in the contained virus strains, inactivation method and composition.

Chickens

Two hundred, 3-week-old specific pathogen free (SPF) chickens were obtained from the SPF Egg Production Farm, Koum Osheim, El-Fayoum, Egypt.

Virus

To assure vaccines potency, chickens were challenged by virulent NDV type 7 NDV-B7-RLQP-CH-EG-12, accessionNoKM288609. This virus strain was also used to hemagglutination (HA) and HI tests. It was kindly obtained from Strain Bank of CLEVB, Abbasia, Cairo, Egypt.

Potency test

A vaccination challenge test was conducted using 3-week-old SPF chicks that were divided into eight groups (25 each group) and kept in separate isolators. Chickens in groups 1 to 7 were vaccinated with ND vaccines; group 8 was the non-vaccinated control group. Chickens were vaccinated as recommended on the vaccine label and kept isolated under observation for at least 28 days. On day 28^th post vaccination, blood samples were collected for haemagglutination inhibition (HI) and then, the vaccinates and at least 10 unvaccinated chickens that had been kept isolated as controls were challenged with Embryo infectious dose 50 (EID ₅₀)/0.1 mL (per bird) of the virulent strain of NDV Genotype 7 (virulent NDV type 7 NDV-B7-RLQP-CH-EG-12) supplied by the CLEVB strain bank and the vaccinates observed each day for 14 days. If at least 90 percent of the controls do not show typical signs of ND or die within 6 days of ND, the test may be repeated. If at least 90 percent of the vaccinated do not remain normal, the vaccine is unsatisfactory as described in Office International des Epizootics (OIE).⁷⁾ The protection percentage of the seven vaccines were measured after vaccination; the percentage of protection should be greater than or equal to 90%.

Hemagglutination inhibition test

On day 28th post vaccination, blood samples were collected for serological tests to determine the ND antibody titer for each vaccine by HI test as described in OIE⁷⁾ The serum samples collected at 28^th day for were tested by HI test to determine the elicited antibody titer against NDV. Two fold serial dilution of serum samples from 1/2 to 1/2048 were applied against 4 hemagglutination (HA) units of ND antigen 10⁶ EID 50/0.1 mL using HA test.⁷ HI antibody titer geometric mean was calculated.^8,9 The mean HI titer should be at least 6 1og_2.

ND Antigen recovery and extraction

Six mL of each oil-emulsion vaccine were mixed and shaked well with 24 mL of IPM for 2 min at 2500/min, then centrifuged for 10 min at 2500 rpm at 4^oC. The resultant aqueous phase was collected separately for each vaccine for ND antigen determination quantification by RT-PCR.¹⁰

RNA extraction

RNA extraction was done for seven extracted ND antigen using QIA amp viral RNA Mini kit (Qiagen, Germany, GmbH). One hundred and forty µL of the ND antigen extract were incubated with 5.6 µL of carrier RNA and 560 µL of AVL lysis buffer at room temperature for 10 min. 560 µL of absolute ethanol was added to the resultant lysate to be washed and centrifuged as recommended by the manufacturer’s instruction. Nucleic acid was then eluted by 60 µL of AE elution buffer.

RT-PCR amplification

The reaction was done in MX3005P RT-PCR machine in a final volume of 25µL containing 3µL of RNA template, 12.5 µL of 2x QuantiTect Probe RT-PCR Master Mix, 8.625 µL PCR grade water, 0.25 µL of each primer (50 pmol conc.) and 0.125 µL of each probe (30 pmol conc.) and 0.25 µL of QuantiTect RT Mix (Table 1). The Reverse transcription was applied at 50^oC for 30 min. Afterwards primary denaturation was adjusted at 94^oC for 15 min. 40 cycles of denaturation at 94^oC for 15 sec were done to be followed by annealing at 55^oC for 30 sec and finally, extension at 72^oC for 10 sec.

All reactions that recorded Ct values were considered positive and reactions that did not record Ct values were considered negative.¹¹

Table 1 Oligonucleotides, primers and probes (Metabion, Germany).¹²  

Gene	Primer/probe sequence 5'-3'
	M+4100 AGTGATGTGCTCGGACCTTC-3’
ND (M)	M-4220 CCTGAGGAGAGGCATTTGCTA-3’
	M+4169 (FAM)TTCTCTAGCAGTGGGACAGCCTGC(TAMRA)-3’

M: matrix protein (M) gene of NDV

Ethical approval

All methods in the study were performed according to relevant guidelines and regulations. All experiments were carried according to ARRIVE 2.0 guidelines and were approved by the Institutional Animal Care and Use Committee (IACUC) in the Faculty of Veterinary Medicine, Cairo University under the code (VetCU01102020217).

Results

Hemagglutination inhibition test and efficacy results (in vivo potency)

Seven different batches of inactivated NDV vaccines were evaluated at CLEVB for their potency by traditional methods (vaccination, serological and challenge test) to reveal satisfactory results (Table 2). These data were considered for further assessment of an alternative method.

To assure the potency of each vaccine, chickens were challenged with the virulent NDV Egyptian isolate of genotype VII. All tested batches could protect vaccinated SPF chickens, the percentage of protection ranged from 90% to 100% (Table 2). The protection percentage shows correspondence with HI antibody titers of sera from vaccinated chickens; the vaccine batch (A) recorded the highest titer 7.1 log₂ with 100% protection, batches (B and C) 6.5 log₂ with 95 % protection, batches (D, E and F) 6.3 log₂ with protection 90% and batch (G) recorded 6.2 log₂ with 90% protection. These results are considered as the starting point of the study to find a coincidence between immune response of each vaccine and the antigen determination (by RT-PCR) as an alternative method to the traditional potency assay.

Table 2 Humoral immune response and protection rates of SPF chickens vaccinated with inactivated NDV vaccines. 

Protective HI antibody titer ≥ 6 (log₂). Protection level (%) of challenge test ≥ 90%.

Real Time PCR

NDV antigens of the tested vaccines were efficiently extracted by oil adjuvant breakdown using IPM to be identified and determined by RT-PCR. Different antigen titers were found (Table 3), but in general, the higher antigen amounts the higher serological response.

When RT-PCR was used to determine NDV antigens it was recorded for vaccine batches G, F, E, D, C, B 25.23 Ct, 24.81 Ct, 24.09 Ct, 23.24 Ct, 22.84 Ct, 22.75 Ct, respectively and for batch A, 21.17 Ct (Table 3). It is noticed that there was coincidence between the HI titers and Ct values.

Table 3 Mean Ct values of the in vitro Real Time PCR for extracted ND antigen. 

Sample No.	HI Titer	Result	Ct value
A	7.1	+	21.17
B	6.5	+	22.75
C	6.5	+	22.84
D	6.3	+	23.24
E	6.3	+	24.09
F	6.3	+	24.81
G	6.2	+	25.23
Control Group	-	-	No Ct

Ct values > 40 reveals negative results.

Coincidence between in vivo and in vitro alternative methods

The coincidence between the in vivo and in vitro evaluation methods obtained for different vaccines batches was outlined in Figure 1.

Fig. 1 Relation between in vivo HI and challenge test and in vitro alternative RT-PCR methods. 

Discussion

The establishment of alternative in vitro potency methods for batch release of inactivated NDV vaccines is a high priority for the Egyptian CLEVB to reduce the cost and save time in relation to in vivo potency testing. Strict batch-to-batch potency assays of all NDV vaccines are applied by CLEVB. Evaluation of inactivated avian viral vaccines, traditionally based on vaccination of 3-week-old SPF chickens with a full dose, is routinely performed to assess the potency of commercial vaccines. When in vivo potency tests were applied, HI antibody titers ≥ 6 log₂ were obtained in serum samples collected 4 weeks post vaccination and at least 90% protection, indicating a satisfactory protection rate. The vaccinated chickens were subjected to challenge test with further observation for 6-day, after these 6 days the trial was considered valid.

According to previous data, the evaluation procedure needs at least 34 days, which is a long period, therefore it is necessary to minimize the evaluation time.^5,7

The known cross-reaction between some avian paramyxoviruses and NDV leads to uncertainty in ND serological assays, like the HI test. Conventional serological tests have an insurmountable barrier for typing. From this point, there is a need to establish a standard molecular assay to accurately detect and quantify NDV antigen. RT-PCR assays play an important role in rapid identification of NDV and also provide its accurate distinguishing from other closely related avian paramyxovirus pathogens. In this study, RT-PCR was introduced as an alternative accurate time-saving protocol.^12,13

The study discusses the use of RT-PCR as an in vitro alternative method for evaluation of inactivated NDV vaccines for poultry. RT-PCR was applied for NDV antigen determination parallel with traditional immunogenic and potency tests to find a coincidence between the in vivo and in vitro techniques. The inactivated NDV antigens could be isolated from water-in-oil emulsion inactivated vaccines by IPM and quantified by RT-PCR. Antigen isolation facilitated the comparison between the amounts of NDV antigen and the titer of ND antibody response post vaccination with seven different inactivated ND vaccines from different manufacturers.

From the mentioned results, amount of NDV antigen looked to be a considerable indicator of serological immune response, as it was clear that the high antigen content resulted in a high antibody titer. These results are in agreement with a previous study¹⁴ that demonstrated the potential of the RT PCR assay as an alternative rapid method to traditional virus titration for evaluation of inactivated viral vaccines. This comparison may be an additional evidence of the in vivo potency and efficacy of the inactivated NDV vaccine. The study considered the results of seven batches of inactivated NDV vaccines which were previously evaluated at CLEVB for their efficacy and potency by using traditional methods including HI and challenge test. The seven vaccine batches revealed satisfactory results for the protection percentage (equal to or higher than 90%) and protective HI antibody titer (greater than 6 log₂).¹⁵

Additionally, serological and vaccination challenge tests are known to have shortcomings because the immune response and protection are measured at specific time point post vaccination under specific standard conditions. On the other hand, the in vitro antigen determination assay is a suitable method for this purpose, being simple, relatively cheap and robust and help avoiding the animals use.³

Globally, there is few antigen determination assays that are accepted as alternatives to potency tests for inactivated vaccines. In Europe, antigen determination is not accepted as an alternative to the in vivo potency assay of veterinary vaccines,¹⁶ but in USA, these assays are used instead of traditional assays for inactivated viral veterinary vaccines.¹⁷

The study recommends the application of Real Time PCR as a reliable technique for evaluation of inactivated ND vaccine efficacy. Furthermore, the relationship between the in vitro amount of antigen and protection percentage has to be calculated for each newly registered vaccine, as it is important to make general criteria for the antigen determination assays by RT-PCR and HI antibody titer for each vaccine.³

Several previous studies have been conducted to apply in vitro potency assays to replace the time consuming in vivo assays, by determination of the NDV antigen content by RT-PCR of tested vaccines after antigen extraction by IPM.^18,19

The present study was established to perform an easy, accurate and fast substitutive protocol to the conventional one. Seven inactivated NDV oil-adjuvanted vaccine samples of batches manufactured by different companies were treated with IPM, resulted in successful extraction of the NDV antigen which was determined using RT-PCR assay.

RT-PCR successfully detected NDV antigen in all extracted vaccine samples which showed a correspondence between the antigen amount measured by RT-PCR assay and the HI titer of collected serum samples at 28 days post vaccination. Hence, the in vivo challenge potency test was applied to confirm the effectiveness of the seven selected batches which recorded Ct values between 21.17 and 25.23 to be used for immunogenicity assays. The obtained results are in agreement with those obtained by a previous study.¹⁰

Previous studies reported a correlation between the in vivo and in vitro potencies for different vaccines regardless the inactivation method. The vaccination challenge study did not reveal clear differences between the in vivo tests for the evaluated vaccines. But the vaccination serology assay revealed that the in vivo potency of the tested vaccines was different as the antibody titer ranged from 7.1 log₂ to 6.2 log₂. Additionally, the potency of the vaccines cannot exceed its limit, including a higher than adequate concentration of antigen administered.³

The RT-PCR technique is characterized by its ability to monitor exactly when the DNA amplification occurs. Using a standard curve allows the analysis of the unknown templates. When comparing conventional methods to RT-PCR, several advantages are found as a high sensitivity, rapidity, low false positives and the accurate analysis. Moreover, RT-PCR is a powerful technique for safe determination of gene expression in addition to its specificity, sensitivity and reproducibility without need to animal immunization.^12,13

On the vaccine evaluation scale, the HI test cannot differentiate vaccinated from infected chickens which to some extent may interfere with the judgment reports by releasing the vaccine batch as satisfactory, but in fact the chicken might be infected.

Conclusions

RT-PCR can be considered a good, fast, safe, accurate, low cost and time saving tool and has the ability to replace the traditional efficacy and potency methodology according to the results obtained. Antigen determination by RT-PCR could replace the in vivo potency method for evaluation of NDV inactivated vaccines.

Acknowledgment

The authors are grateful and thankful to the CLEVB and Cairo University for their appreciated cooperation and support.

References

1.  Butt SL, Moura V, Susta L, Miller PJ, Hutcheson JM, Cardenas-Garcia S, et al. Tropism of Newcastle disease virus strains for chicken neurons, astrocytes, oligodendrocytes and microglia. BMC Vet Res. 2019; 15(1): 317. doi: https://10.1186/s12917-019-2053-z.

2.  Abozaid KGA, Abdel-Moneim AS. Epidemiological surveillance of Newcastle disease virus in Egypt - a 6-year cohort study. Trop Anim Health Prod. 2022;54(4):243. doi: https://10.1007/s11250-022-03234-3. PMID: 35909216.

3.  Ike AC, Ononugbo CM, Obi OJ, Onu CJ, Olovo CV, Muo SO, et al. Towards Improved Use of Vaccination in the Control of Infectious Bronchitis and Newcastle Disease in Poultry: Understanding the Immunological Mechanisms. Vaccines (Basel). 2021;9(1):20. doi: https://10.3390/vaccines9010020.

4.  Egyptian Standards Regulations for Evaluation of Veterinary Biologics. 3rd edition. 2017.

5.  Cheung CY, Dubey S, Hadrovic M, Ball CR, Ramage W, McDonald JU, et al. Development of an ELISA-Based Potency Assay for Inactivated Influenza Vaccines Using Cross-Reactive Nanobodies. Vaccines (Basel). 2022; 10 (9): 147. doi: https://10.3390/vaccines10091473.

6.  Valasek MA, Repa JJ. The power of real-time PCR. Adv Physiol Educ. 2005; 29: 151-9. doi: https://10.1152/advan.00019.2005.

7.  Organization for Animal Health (OIE). New castle Disease (Infection with New Castle Disease Virus). En: OIE. World Organization for Animal Health. Manual of diagnostic tests and vaccines for terrestrial animals (mammals, birds, bees). Paris: OIE; 2021. p. 1-22. Available from: https://www.woah.org/fileadmin/Home/eng/Health_standards/tahm/3.03.14_NEWCASTLE_DIS.pdf7.  . (Acces on: May 19, 2022).

8.  Newcastle Disease Vaccine Killed Virus. 9 CRF 113.205. 2022.

9.  Kärber G. Beitrag zur kollektiven Behandlung pharmakologischer Reihenversuche. Archiv f experiment Pathol u Pharmakol.162:480-3. 1931.

10.  Aly SE, Hussein HA, Aly AM, Abdel-Baky MH, El-Sanousi AA. Assessment of in vitro10.  potency of inactivated Newcastle disease oil-adjuvanted vaccines using hemagglutination test and blocking ELISA. Vet World. 2018; 11 (9): 1222-8. doi:https://10.14202/vetworld.2018.1222-122810.  .

11.  Haegeman A, De Vleeschauwer A, De Leeuw I, Vidanović D, Šekler M, Petrović T, et al. Overview of diagnostic tools for Capripox virus infections. Prev Vet Med. 2022; 181:104704. doi: https://10.1016/j.prevetmed.2019.104704 .

12.  El-Tholoth M, Branavan M, Naveenathayalan A, Balachandran W. Recombinase polymerase amplification-nucleic acid lateral flow immunoassays for Newcastle disease virus and infectious bronchitis virus detection. Mol Biol Rep. 2019;46(6):6391-7. doi: https://10.1007/s11033-019-05085-y12.  .

13.  Zeynalova S, Guliyev F, Vatani M, Abbasov B. Biosurveillance of avian influenza and Newcastle disease viruses in the Barda region of Azerbaijan using real time RT-PCR and hemagglutination inhibition. Front Microbiol. 2015;6:1128. doi: https://10.3389/fmicb.2015.0112813.  .

14.  Abousenna MS, Amal AM, Darwish MD, Khafagy HA, Shasha FA, Barghooth WM, et al. Using of real time PCR as a tool for quantification of sheep pox virus. J Anim Health Prod. 2020; 8 (2): 45-9. doi: https://10.14737/journal.jahp/2020/8.2.45.4914.  .

15.  Bodle J, Verity EE, Ong C, Vandenberg K, Shaw R, Barr IG, et al. Development of an enzyme-linked immunoassay for the quantitation of influenza haemagglutinin: An alternative method to single radial immunodiffusion. Influenza Other Respir Viruses.2013; 7: 191-200. doi: https://j.1750-2659.2012.00375.x .

16.  European Directorate for the Quality of Medicines & HealthCare (EDQM). European Pharmacopoeia 10^th16.  ed. Strasbourg: EDQM; 2021.

17.  Code of Federal Regulations (CFR). Title 9 Parts 1-199. Washington DC: US Government Printing Office;2000. Available at:. http://www.gpo.gov/fdsys/pkg/CFR-2006-title9-vol1/pdf/CFR-2006-title9- vol1-chapI.pdf17.  .

18.  Abdel Rahman SS, Abel Wanis NA, Aly MA, Abdel-Rahman A, Sae A. Detection of antigen content of inactivated oil Newcastle disease vaccines by a new laboratory method. Kafer El-Sheikh Vet Med J. 2006; 4: 267-76.

19.  Motitschke A, Jungbäck C. The quantitative ELISA for inactivated Newcastle antigen: Experience report from an OMCL. Dev Biol. 2011; 134: 55-66.

Received: December 01, 2022; Accepted: March 13, 2023

Corresponding author: [e-mail]

Conflict of interest The authors declare that there is no conflict of interest.

Author’s contributions Mounir El Safty: designed the experiments. Hala Mahmoud: performed the experiments and wrote the manuscript. Reem A Soliman: performed the experiments and wrote the manuscript. All authors reviewed and approved the final version of this manuscript for publication.

⁽PhD, senior researcher at Agriculture Research Center, Central Laboratory for Evaluation of Veterinary Biologics, Cairo, Egypt.