SciELO - Scientific Electronic Library Online

 
vol.38 issue1An enzyme-linked immunosorbent assay (ELISA) for serological detection of antibodies against Borrelia in calves in BrazilToxicosis in goat by Mulato grass (Brachiaria ruziziensis- Brachiaria brizantha) in Artemisa province author indexsubject indexarticles search
Home Pagealphabetic serial listing  

My SciELO

Services on Demand

Journal

Article

Indicators

  • Have no cited articlesCited by SciELO

Related links

  • Have no similar articlesSimilars in SciELO

Share


Revista de Salud Animal

Print version ISSN 0253-570XOn-line version ISSN 2224-4700

Rev Salud Anim. vol.38 no.1 La Habana Jan.-Apr. 2016

 

ARTÍCULO ORIGINAL

 

Análisis de la secuencia de la proteína principal de superficie 1a en aislados cubanos de Anaplasma marginale

 

Analysis of major surface protein 1a sequence in Cuban isolates of Anaplasma marginale

 

 

Belkis Corona GonzálezI*, Adrian Díaz SánchezI, Yoandry Hinojosa LópezI, Dasiel Obregón ÁlvarezII, Claudia Bezerra Da SilvaIII, Maristela Peckle PeixotoIII, Marcus Sandes PiresIII, Huarrisson Acevedo SantosIII, Siomara Martínez MarreroI, Adivaldo Henrique da FonsecaIII, Carlos Luiz MassardIII

IDirección de Salud Animal, Centro Nacional de Sanidad Agropecuaria (CENSA), Apartado 10, San José de las Lajas, Mayabeque, Cuba. Correo electrónico: bcorona@censa.edu.cu.
IIUniversidad Agraria de la Habana, San José de las Lajas, Mayabeque, Cuba.
IIIUniversidad Federal Rural de Rio de Janeiro, UFRRJ, BR 465, Km 7, Rio de Janeiro, Seropédica 23890-000.

 

 


RESUMEN

La anaplasmosis bovina es una enfermedad causada por la rickettsia Anaplasma marginale. Las principales proteínas de superficie de esta bacteria, codificadas por genes con secuencias conservadas, constituyen candidatos potenciales para vacunas. Dentro de estas proteínas, MSP1a se expresa por un gen de simple copia (msp1a) y su peso molecular varía entre aislados de A. marginale de diferentes regiones geográficas debido a la presencia, en número variable, de una secuencia de 28-29 aminoácidos repetida en tándem. En el presente estudio se analizaron las secuencias de los repetidos y del microsatélite de la proteína MSP1a de dos aislados de A. marginale provenientes de bovinos de una granja de la región occidental de Cuba. Ambos aislados pertenecen al genotipo G y el aislado 21G presenta los repetidos T-B-B-C y el 25G los tipos T-C. El análisis de estas secuencias repetidas resulta muy importante, pues incluyen marcadores para la transmisibilidad por garrapatas y son de gran valor para el desarrollo de un futuro candidato vacunal contra este hemoparásito.

Palabras clave: anaplasmosis bovina, msp1a, MSP1a, proteínas principales de superficie.


ABSTRACT

The bovine anaplasmosis is a disease of cattle caused by the rickettsia Anaplasma marginale. The major surface proteins encoded by genes with conserved sequences are potential candidates for vaccines. Among these proteins, MSP1a is expressed by a single copy gene (msp1a). The molecular weight of MSP1a varies among A. marginale isolates from different geographical regions due to the presence, in a variable number, of a sequence of 28-29 amino acids in tandem repeats. In the present study, the sequences of the repeats and of the microsatellite of the protein MSPla of two isolates of A. marginale from bovines in a farm of the Cuban western region were examined. Both isolates belongs to the genotype G, and the isolate 21G presented the repeats T-B-B-C and the 25G of the types T-C. The analysis of these repeated sequences are very important because they include markers for transmissibility by ticks and are of great value for the future development of a vaccine candidate against this hemoparasite.

Key words: bovine anaplasmosis, msp1a, MSP1a, major surface proteins.


 

 

INTRODUCCIÓN

Anaplasma marginale es una rickettsia Gram negativa, que se transmite por la garrapata Rhipicephalus (Boophilus) microplus (1), y se considera el vector biológico más importante en las regiones tropicales y subtropicales del mundo (2).

Se han identificado y caracterizado varias proteínas de superficie de A. marginale que están involucradas en la interacción con los hospederos vertebrados e invertebrados (3).

Muchos aislados de A. marginale de diferentes orígenes geográficos difieren en la secuencia de las proteínas, en las características antigénicas y en su habilidad para ser transmitidas por garrapatas (4). La diversidad genética de aislados de A. marginale provenientes de eritrocitos bovinos, se ha caracterizado a partir de las secuencias de los genes que codifican para las proteínas principales de superficie (MSP), varias de las cuales han demostrado estar involucradas en las interacciones patógeno-célula hospedera (5).

La proteína MSP1a es una de las seis proteínas principales de superficie descritas para A. marginale, la cual es codificada por un gen de simple copia, conservado durante la multiplicación en el bovino y las garrapatas (6).

La proteína MSP1a de aislados de A. marginale, procedentes de diferentes regiones geográficas, difiere en su peso molecular debido al número variable de secuencias repetidas en tándem de 23 -31 aminoácidos que estas presentan. Se ha demostrado que esta proteína es un marcador estable para la identificación de aislados (7, 8).

Los estudios previos demuestran que la proteína MSP1a de A. marginale está sometida a selección positiva (6) y el análisis de los repetidos proporciona evidencias de co-evolución del patógeno en las garrapatas (3).

El objetivo del presente estudio fue analizar las secuencias de los repetidos y del microsatélite de la proteína MSP1a de dos aislados de A. marginale provenientes de bovinos de una granja en la región occidental de Cuba.

 

MATERIALES Y MÉTODOS

Selección de las muestras: Se trabajó con dos muestras de sangre de bovinos, provenientes de una granja de la región occidental de Cuba. Los animales no presentaban signos clínicos típicos de la enfermedad. Se les realizó el diagnóstico de A. marginale a partir de la amplificación por nPCR del gen msp5 de este hemoparásito, según el protocolo descrito por Torioni et al., (9) (resultados no publicados) y se les denominó aislamiento 21G y 25G.

Extracción de ADN y amplificación por PCR del gen msp1a: La extracción del ADN genómico se realizó con el estuche comercial Blood and Tissue DNA Purification Kit (QIAGEN), según las indicaciones del fabricante y la concentración del ADN extraído se determinó en un equipo NanoDrop (200 Spectrophotometer). Para la amplificación del gen msp1a se utilizaron los cebadores descritos por Palmer et al. (10) (Sentido: 5´GTGCTTATGGCAGACATTTCC3´; antisentido: 5´CTCAACACTCGCAACCTTGG3´). La reacción de amplificación se realizó en un volumen final de 50 µl, conteniendo 50 ng de ADN, 0.4 µM de cada cebador y 1X GoTaq® Green Master Mix (Promega®, Madison, USA). Las condiciones de amplificación fueron las siguientes: 95°C durante 5 min, seguido de 30 ciclos de 95°C por 2 min, 58°C por 30 seg, 72°C por 1 min y una extensión final de 72°C durante 10 min, en un ThermalCycler GeneAmp PCR System 9700 (Perkin Elmer).

Los resultados del PCR se aplicaron en geles de agarosa (Sigma) al 1%, en tampón TBE 0.5 X; se corrieron a 100 Volts y 50mA, en cámara de electroforesis Maxiphor 2012 (LKB Bromma) durante 35 minutos en tampón de corrida (TBE 0.5X) que contenía Bromuro de Etidio (0.5 µg/ml). Los resultados se visualizaron en un transiluminador de luz ultravioleta y se fotografiaron con cámara digital (Olympus). Se utilizó un marcador depeso molecular de 1kb (DNA Ladder, Promega).

Los productos amplificados se purificaron con el estuche comercial QIAquick PCR Purification Kit (QIAGEN) y se cuantificaron utilizando el equipo NanoDrop (200 Spectrophotometer).

Secuenciación de los fragmentos amplificados: Los fragmentos amplificados se secuenciaron utilizando el estuche comercial BigDye Terminator (Applied Biosystems), en un equipo ABI 3130, Applied Biosystems. Para cada aislado se realizaron tres reacciones de secuenciación con los mismos cebadores que se utilizaron para la amplificación del gen msp1a.

El ensamblaje y edición de las secuencias se realizó con el programa Sequencher Versión 4.8 Demo (Gene Codes Corporation). La secuencia deducida de aminoácidos se obtuvo a través del sitio web Swissprot Expassy (http://web.expasy.org/translate/). Las secuencias se depositaron en el GenBank. Posteriormente, se compararon con las secuencias de nucleótidos y aminoacídicas disponibles en el GenBank, utilizando el programa Blastn (http://blast.ncbi.nlm.nih.gov/blastn).

Clasificación de los aislados de A. marginale: Para la el análisis de las secuencias obtenidas se tuvo en cuenta la clasificación de las secuencias repetidas en tándem (del inglés Sequence Repeat Tandem, SRT) y se denominaron según la nomenclatura propuesta por Allred et al. (7) y de la Fuente et al. (8). La secuencia del microsatélite se utilizó para asignar un genotipo siguiendo el sistema de Estrada-Peña et al. (11). Para calcular la distancia entre entre Shine-Dalgarno (SD) y el codón de inicio de la transcripción (ATG) se utilizó la fórmula (4 × m) + (2 × n) + 1 y según su estructura se clasificaron los aislamientos como genotipos, identificados por letras entre A y K (11,12).

 

RESULTADOS Y DISCUSIÓN

Las secuencias obtenidas para el gen msp1a de Anaplasma marginale de los dos aislados cubanos en estudio (21G y 25G) se depositaron en el GenBank con los números de acceso KT732269 y KT732270, respectivamente. En el análisis de la secuencia del microsatélite se encontró que ambos aislados pertenecen al genotipo G (Tabla 1).

Estos resultados coinciden con Estrada-Peña et al. (11), quienes encontraron el genotipo G en el 68% (n=115) de los aislados de A. marginale, procedentes de varios países en todos los continentes. El microsatélite se localiza en la región 5´UTR de MSP1a, entre la secuencia de Shine-Dalgarno y el codón de inicio de la transcripción (ATG). Este tiene dos tipos de secuencia: (G/ATTT)m y (GT)n. Las diferentes secuencias del microsatélite producen distancias entre SD y el ATG entre 19 y 29 nucleótidos, pero la distancia de 23 nucleótidos es predominante en todas las regiones estudiadas por Estrada-Peña et al. (11). Estos autores plantean que esta región está implicada en la regulación de los niveles de expresión de la proteína MSP1a y demostraron que la expresión de la proteína fue menor en construcciones, expresadas en Escherichia coli, para cepas con 19 nucleótidos de distancia entre SD y el ATG; sin embargo, no se observaron diferencias entre construcciones de las cepas con distancias entre 23 y 29 nucleótidos entre SD y el ATG, lo que podría afectar la expresión de MSP1a, que varía durante la multiplicación de A. marginale en las células de garrapatas y en los eritrocitos bovinos, la infección por el patógeno y la transmisión (13).

Con relación a los repetidos en tándem encontrados en la proteína MSP1a de los aislados en estudio, el repetido T está presente en ambos aislados en la posición R1, según lo descrito por Estrada-Peña et al. (11), y el resto de los repetidos (C-B-F) es diferente para los dos aislados (Tabla 2). Cuando se comprara el tipo de repetidos de estos aislados con los descritos por Corona et al. (14) para otro aislado cubano (HA), de la región occidental, pero de una granja diferente, se puede observar que el repetido B está también presente en el aislado 21G, pero con diferente número de repeticiones (Tabla 2).

En este sentido, de la Fuente et al. (15) caracterizaron 11 aislamientos de Oklahoma, y encontraron diferencias en las secuencias de este gen para todos los aislamientos. Se conoce que la proteína MSP1a de diferentes aislados difiere en el peso molecular debido al número variable de repeticiones en tándem de 23-31 aminoácidos (7, 10).

Tal heterogeneidad genética observada entre cepas de A. marginale en regiones endémicas podría explicarse por el movimiento y mantenimiento de diferentes genotipos de ganado, por los acontecimientos de transmisión independiente, debido a la exclusión de la infección por A. marginale en el ganado y las garrapatas que se traduce en el establecimiento de un único genotipo de A. marginale por animal (16).

El repetido B está entre los repetidos más comunes en los aislados de A. marginale de América (12). Además, el repetido T también es frecuente en los aislados en Estados Unidos de América y Latinoamérica (8). En este trabajo se encontró similitud entre los repetidos en tándem que se encuentran en los aislados de A. marginale procedentes de Cuba y en otros países de América,

El gen msp1a es estable durante la multiplicación en los hospederos vertebrados e invertebrados (12). No obstante, existe diversidad genética (msp1a) entre los aislados en áreas endémicas en EUA, México, Argentina, Brasil y otros países; esto soporta la teoría del surgimiento de nuevas cepas que se mantienen en los rebaños y se encuentra una secuencia por animal, por el fenómeno de la exclusión de la infección que caracteriza la interacción de esta rickettsia y sus hospederos (15,17).

El estudio de estas secuencias repetidas resulta muy importante, pues incluyen marcadores para la transmisibilidad por garrapatas (15). El mecanismo de infección y transmisión de A. marginale por garrapatas es importante en la formulación de las estrategias de control y en el desarrollo de vacunas mejoradas contra la anaplasmosis. Esto es de suma importancia además, pues se sabe que la secuencia de MSP1a está conservada en todo el ciclo de vida de A. marginale, (18), lo que indica que esta proteína resulta un potencial candidato vacunal contra la anaplasmosis.

 

AGRADECIMIENTOS

Agradecemos al Proyecto CAPES/MES Cuba188/2013 por el financiamiento para esta investigación.

 

REFERENCIAS

1. Kocan KM, de la Fuente J, Blouin EF, Coetzee JF, Ewing SA. The natural history of Anaplasma marginale. Vet Parasitol. 2010;167:95-107.

2. Estrada-Peña A, Bouattour A, Camicas JL, Guglielmone A, Horak I, Jongejan F, et al. The known distribution and ecological preferences of the tick subgenus Boophilus (Acari: Ixodidae) in Africa and Latin America. Exp Appl Acarol. 2006;38:219-235.

3. de la Fuente J, Kocan KM, Blouin EF, Zivkovic Z, Naranjo V, Almazán C, et al. Functional genomics and evolution of tick-Anaplasma interactions and vaccine development. Vet Parasitol. 2010;167(2-4):175-86.

4. Kocan KM, de la Fuente J, Blouin EF, Garcia-Garcia JC. Anaplasma marginale (Rickettsiales: Anaplasmataceae): recent advances indefining host-pathogen adaptations of a tick-borne rickettsia. Parasitol. 2004;129:S285-S300.

5. Palmer GH, Rurangirwa FR, Kocan KM, Brown WC. Molecular basisfor vaccine development against the ehrlichial pathogen Anaplasma marginale. Parasitol Today. 1999;15:281-286.

6. de la Fuente J, Van Den Bussche RA, Prado TM, Tocan KM. Anaplasma marginale msp1a genotypes evolved under positive selection pressure but are not markers for geographic isolates. J Clin Microbiol. 2003;41:1609-1616.

7. Allred DR, McGuire TC, Palmer GH, Leib SR, Harkins TM, et al. Molecular basis for surface antigen size polymorphisms and conservation of a neutralization-sensitive epitope in Anaplasma marginale. Proc Natl Acad Sci. 1990;87:3220-3224.

8. de la Fuente J, Ruybal P, Mtshali MS, Naranjo V, Shuqing L, Mangold AJ, et al. Analysis of world strains of Anaplasma marginale using major surface protein 1a repeat sequences. Vet Microbiol. 2007;119:382-390.

9. Torioni de Echaide S, Knowles DP, McGuire TC, Palmer GH, Suarez CE, McElwain FF. Detection of cattle naturally infected with Anaplasma marginale in a region of endemicity by nested PCR and a competitive enzyme-linked immunosorbent assay using recombinant major surface protein 5. J Clin Microbiol. 1998;36:777-782.

10.Palmer GH, Knowles DP Jr, Rodriguez JL, Gnad DP, Hollis LC, et al. Stochastic transmission of multiple genotypically distinct Anaplasma marginale strains in a herd with high prevalence of Anaplasma infection. J Clin Microbiol. 2004;42:5381-5384.

11.Estrada-Peña A, Naranjo V, Acevedo-Whitehouse K, Mangold AJ, Kocan KM, et al. Phylogeographic analysis reveals association of tick-borne pathogen, Anaplasma marginale, MSP1a sequences with ecological traits affecting tick vector performance. BMC Biol. 2009;7:57.

12.Cabezas-Cruz A, Passos LMF, Lis K, Kenneil R, Valdés JJ, Ferrolho J, et al. Functional and Immunological Relevance of Anaplasma marginale Major Surface Protein 1a Sequence and Structural Analysis. PloS ONE. 2013;8:e65243.

13.Garcia-Garcia JC, de la Fuente J, Bell-Eunice G, Blouin EF, Kocan KM. Glycosylation of Anaplasma marginale major surface protein 1a and its putative role in adhesion to tick cells. Infec Immun. 2004;72:3022-3030.

14.Corona B, Minet C, Albina E, Vega A, Martínez S. Sequence of msp1a gene of Anaplasma marginale Havana isolate and expression in eukaryotic cells. Span J Agric Res. 2005;3(3):275-280.

15.de la Fuente J, Blouin EF, Kocan KM. Infection exclusion of the rickettsial pathogen, Anaplasma marginale, in the tick vector, Dermacentor variabilis. Clin Diagn Lab Immunol. 2003;10:182-184.

16.de la Fuente J, Van Den Bussche RA, Garcia-Garcia JC, Rodriguez SD, Garcia MA, Guglielmone AA, et al. Phylogeography of New World isolates of Anaplasma marginale based on major surface protein sequences. Vet Microbiol. 2002;88:275-285.

17.Lew A, Jorgensen W. Molecular approaches to detect and study the organisms causing bovine tick borne diseases: babesiosis and anaplasmosis. Afr J Biotech. 2005;4(4):292-302. Retrieved from http://www.academicjournals.org/AJB.

18.Bowie MV, de la Fuente J, Kocan KM, Blouin EF, Barbet AF. Conservation of major surface protein 1 genes of Anaplasma marginale during cyclic transmission between ticks and cattle. Gene. 2002;282:95-102.

 

 

Recibido: 4-11-2015.
Aceptado: 20-3-2016.

Creative Commons License All the contents of this journal, except where otherwise noted, is licensed under a Creative Commons Attribution License