SciELO - Scientific Electronic Library Online

 
vol.36 issue1Multiplication of AMF infective propagules in a mulberry (Morus alba L.) plantationYield of dry matter and other components in Leucaena leucocephala cv. Cunningham using Liplant author indexsubject indexarticles search
Home Pagealphabetic serial listing  

My SciELO

Services on Demand

Journal

Article

Indicators

  • Have no cited articlesCited by SciELO

Related links

  • Have no similar articlesSimilars in SciELO

Share


Pastos y Forrajes

Print version ISSN 0864-0394

Pastos y Forrajes vol.36 no.1 Matanzas Jan.-Mar. 2013

 

ARTÍCULO DE INVESTIGACIÓN

 

 

Potencial biofertilizante de bacterias diazótrofas aisladas de muestras de suelo rizosférico

 

Biofertilizer potential of diazotrophic bacteria isolated from samples of rhizospheric soil

 

 

 

Laura Y. Moreno y F. Galvis

Grupo de Investigación Majumba, Universidad Francisco de Paula. Santander, Cúcuta, Norte de Santander, Colombia
E-mail: lauramoreno_08@hotmail.com

 

 

 


RESUMEN

Las bacterias promotoras del crecimiento vegetal son capaces de adaptarse, colonizar y persistir en la rizosfera de la planta, lo cual favorece su crecimiento y desarrollo. En este trabajo se aislaron 32 cepas nativas de bacterias diazótrofas, a partir de muestras de suelo rizosférico de diferentes cultivos, identificadas mediante los medios de cultivo tradicionales y el sistema BBL CRYSTAL. La identificación bioquímica se realizó a través de la reacción en cadena de la polimerasa (PCR, del inglés Polymerase Chain Reaction). Nueve aislados se determinaron como Stenotrophomonas maltophilia y uno como Azotobacter vinelandii, de los cuales tres coincidieron en la identificación bioquímica y la molecular. Se realizó un ensayo en invernadero para evaluar el efecto fertilizante en plantas de maíz, según un diseño experimental de bloques al azar y nueve tratamientos, por triplicado: tratamiento 1: A. vinelandii ATCC 9046; tratamientos del 2 al 7 para los seis aislados; tratamiento 8 para fertilización química; y tratamiento 9 para suelo sin fertilización (testigo). Los aislados M8-10, M10-1 y M11-3, identificados como S. maltophilia por PCR, tuvieron mejores resultados en la emergencia de las plantas, el diámetro del tallo y la longitud de las hojas y los tallos. Finalmente se determinó que M10-1 mostró valores de emergencia y crecimiento de la planta por encima de la media y el límite superior, con respecto a los demás aislados y controles, lo cual lo convierte en un potencial biofertilizante.

Palabras clave: bacteria, fijación de nitrógeno.


ABSTRACT

Plant growth promoting bacteria are capable of adapting, colonizing and persisting in the plant rhizosphere, which favors plant growth and development. In this work 32 native strains of diazotrophic bacteria were isolated, from rhizospheric soil samples of different crops, identified through traditional soil cultures and the BBL CRYSTAL system. The biochemical identification was made through polymerase chain reaction (PCR). Nine isolates were determined as Stenotrophomonas maltophilia and one as Azotobacter vinelandii, of which three coincided in the biochemical and molecular identification. A greenhouse trial was conducted to evaluate the fertilizer effect on corn plants, according to a randomized block design and nine treatments, in triplicate: treatment 1: A. vinelandii ATCC 9046; treatments from 2 to 7 for the six isolates; treatment 8 for chemical fertilization; and treatment 9 for soil without fertilization (control). The isolates M8-10, M10-1 and M11-3, identified as S. maltophilia by PCR, had better results in plant emergence, stem diameter and leaf and stem length. Finally, M10-1 was determined to show plant emergence and growth values higher than the mean and upper limit, as compared with the other isolates and controls, which makes it a potential biofertilizer.

Key words: bacterium, nitrogen fixation.


 

 

INTRODUCCIÓN

La actividad biológica de los suelos tiene un papel preponderante en el logro de cultivos de alto rendimiento. Los microorganismos en asociación con los cultivos son importantes, como insumos, para el mejoramiento de la producción y el control ambiental; además permiten el mantenimiento de la biodiversidad y la sostenibilidad de los ecosistemas (Carvajal y Mera, 2010).

Las bacterias de vida libre, o en simbiosis, que habitan la rizosfera pueden estimular el crecimiento de las plantas a través de diferentes procesos, como la síntesis de reguladores del crecimiento vegetal, la fijación de nitrógeno, la solubilización de nutrientes, la producción de sideróforos y el control de fitopatógenos del suelo (Torriente, 2010). Los microorganismos más estudiados pertenecen a los géneros Azotobacter, Stenotrophomonas, Azospirillum, Klebsiella, Beijerinckia, Pseudomonas y Bacillus, entre otros; estos se denominan bacterias promotoras del crecimiento vegetal (PGPR, del inglés Plant Growth Promoting Rhizobacteria), algunos PGPR transforman el nitrógeno atmosférico en amonio (proceso conocido como fijación biológica de nitrógeno) para que pueda ser incorporado a la biosfera, lo cual representa un beneficio económico y reduce el impacto negativo en el ambiente, debido al uso exagerado de insumos químicos en la producción agrícola (Bruinsma, 2003).

Se requiere el aislamiento e identificación de microorganismos nativos con propiedades que promuevan el crecimiento vegetal y presenten mayor permanencia en el campo, como Azotobacter vinelandii, Stenotrophomonas maltophilia y Burkholderia cepacia, y así poder evaluar el potencial biofertilizante en cultivos de interés agronómico. Para la identificación de las bacterias diazótrofas se emplean técnicas convencionales o basadas en sus propiedades bioquímicas, tales como: la descripción de su morfología celular, la coloración Gram, el análisis de su capacidad para crecer en condiciones aerobias o anaerobias, o el análisis de requerimientos de sustratos especiales para su cultivo; estas técnicas permiten su identificación hasta género. Para la caracterización de especies, subespecies, serovariedades o cepas, se precisa de técnicas más sensibles y específicas, como la reacción en cadena de la polimerasa (PCR) que identifica una secuencia única en el ADN.

El objetivo del trabajo fue identificar, mediante BBL Crystal™ Enteric/Nonfermenter ID Kit y PCR, microorganismos diazótrofos aislados a partir de muestras de suelo rizosférico en cultivos de interés agronómico, así como comprobar su efecto biofer-tilizante en plantas de maíz.

 

MATERIALES Y MÉTODOS

Recolección y caracterización de las muestras de suelo. Las muestras se tomaron de suelos rizosféricos de 16 sitios diferentes, con cultivos de pastos, café, caña de azúcar, maíz y frutales; estos se ubican en el municipio de Chinácota, Norte de Santander, Colombia. Para la recolección, el transporte y la conservación de las muestras se emplearon las metodologías propuestas por Cline (1944) y Sosa (2002). Se realizó un análisis fisicoquímico en el laboratorio de suelos agrícolas de la Universidad Francisco de Paula, en Santander Cúcuta, Colombia (Olarte et al., 1979), y un análisis de la materia seca; se determinó el pH, el fósforo, el potasio, el calcio y el magnesio.

Aislamiento mediante medios selectivos. El aislamiento de las bacterias diazótrofas se realizó mediante los medios Winogradsky y Agar Ashby. A continuación se determinaron las características macroscópicas y microscópicas de los aislados puros. Para la clasificación de los aislados se utilizó la siguiente nomenclatura: aislado M3-1, donde: M corresponde a la muestra de suelo; 3, al número de muestra; y 1, al número de cepas puras obtenidas.

Caracterización bioquímica mediante BBL CRYSTAL. Se realizó la identificación bioquímica mediante BBL Crystal™ Enteric/Nonfermenter ID Kit. El sistema de identificación incluye pruebas para la fermentación, la oxidación, la degradación y la hidrólisis de diversos sustratos.

Identificación molecular. Para el aislamiento del ADN de los aislados y el control A. vinelandii ATCC 9046, se utilizó el UltraClean® Microbial DNA Isolation Kit de MoBio. En la identificación molecular se emplearon los cebadores específicos nifH-g1-for GGTTGTGACCCGAAAGCTGA y nifH-g1-rev GCGTACATGGCCATCATCTC, para A. vinelandii (Bürgmann, Wilmer, Sigler y Zeyer, 2003; Levy-Booth y Winder, 2010); SM1-for CAGCCTGCGAAAAGTA y SM4-rev TTAAGCTTGCCACGAACAG, para S. maltophilia (Whitby et al., 2000; Kisková et al., 2012); y G1c-for GCCATGGATACTCCAAAAGGA y G2c-rev TCGGAATCCTGCTGAGAGGC, para B. cepacia (Whitby et al., 2000; Rashamuse, Burton y Cowan, 2007). Las muestras de ADN fueron amplificadas en un volumen final de 50 µl, el cual contenía 1X buffer para PCR; 2,5 mM MgCl2, 200 mM dNTP, 1 U de Taq polimerasa (Bioline), 1 µM de cada primer y 2 µl de ADN. Las condiciones de la amplificación consistieron en una desnaturalización inicial a 95°C por cinco minutos, seguida de 30 ciclos de 95°C por un minuto, 60°C por 30 segundos y 72°C por un minuto; y una extensión final a 72°C por 7 minutos. Los productos de la PCR fueron visualizados en geles de agarosa al 1 % y teñidos con bromuro de etidio.

Efecto biofertilizante. Se realizó un ensayo en invernadero con plantas de maíz para evaluar el porcentaje de emergencia de estas, el diámetro del tallo y la longitud de las hojas y de los tallos; se comparó el efecto de seis aislados identificados por PCR (M-1, M8-4, M8-9, M8-10, M10-1 y M11-3) con el de la fertilización química y un testigo. Los tratamientos se inocularon en 80 mL de medio líquido LB (10 g de triptona, 10 g de NaCl y 5 g de extracto de levadura/L), con agitación constante a temperatura ambiente por 24 horas, hasta alcanzar una concentración mínima de 108 células/mL (escala de Macfarland). La inoculación de las semillas se realizó según lo propuesto por Utria-Borges et al. (2008). En el ensayo se utilizó un diseño experimental de bloques al azar y nueve tratamientos, por triplicado: tratamiento 1: A. vinelandii ATCC 9046; tratamientos 2 al 7 para los seis aislados; tratamiento 8 para la fertilización química; y tratamiento 9 para el suelo sin fertilización (testigo). Las comparaciones entre las medias se realizaron mediante Duncan (1955) y se utilizó una estadística ANOVA con el programa SPSS 15.0.

 

RESULTADOS Y DISCUSIÓN

Identificación con el uso de medios selectivos y pruebas bioquímicas. El análisis de las muestras de suelo rizosférico mostró un pH entre moderadamente ácido (5,1) y medianamente alcalino (7,8); promedios de: materia orgánica 7,12 %; fósforo 262,5 ppm; potasio 0,58 meq/100 g; calcio 17,6 meq/100 g y magnesio 2,1 meq/100 g; y textura franca y franco-arenosa. Estos resultados se encuentran dentro de los rangos que favorecen la permanencia y la actividad de las bacterias diazótrofas. No se observó ninguna correlación entre las características fisicoquímicas del suelo y la cantidad de aislados obtenidos a partir de cada muestra.

En medios selectivos se obtuvieron 32 aislados puros, los cuales se correspondieron con bacterias fijadoras de nitrógeno. El análisis con el sistema BBL CRYSTAL permitió identificar Klebsiella pneumoniae subesp. ozaenae, Klebsiella oxytoca o Serratia rubidea, K. oxytoca o K. pneumoniae, K. pneumoniae, K. oxytoca, S. maltophilia, Aeromonas hydrophila o Enterobacter sakazakii, E. cloacae o E. sakazakii, E. cloacae, B. cepacia, B. cepacia o Pseudomonas fluorescens y Serratia fonticula.

Identificación molecular. En el análisis molecular de A. vinelandii mediante PCR, con la utilización de los cebadores nifH-g1-for y niH-g1-rev (fig. 1a), se observó una banda de 370 pb en el aislado M8-4, que es una amplificación adecuada según señalan Bürgmann et al. (2003) y Levy-Booth y Winder (2010). En la identificación de S. maltophilia, los cebadores SM1-for y SM4-rev reconocieron los aislamientos M1, M2, M4-1, M6-3, M8-3, M8-9, M8-10, M10-1 y M11-3 (fig. 1b), y amplificaron una banda de 531 pb, que se corresponde con lo planteado por Whitby et al. (2000) y Kiskova et al. (2012) (fig. 1b). La amplificación con el uso de los cebadores G1c-for y G2c-rev para la identificación de B. cepacia no mostró resultados, lo que posiblemente se debió a que ninguno de los aislamientos analizados molecularmente correspondía a esta. El análisis de los cebadores G1c-for y G2c-rev realizado en BLAST mostró una alta especificidad para el género Burkholderia, ya que reconoció las especies B. cepacia, B. cenocepacia y B. ambifaria.

Al comparar los resultados de PCR con los de BBL CRYSTAL se halló que el aislamiento M8-4 correspondió a A. vinelandii mediante PCR; mientras que con bioquímica, a S. maltophilia. Los aislados M2, M8-9 y M8-10 se identificaron por PCR y BBL CRYSTAL como S. maltophilia.

A través de bioquímica los aislados M4-1, M6-3 y M11-3 se identificaron como B. cepacia; M10-1 como Klebsiella sp.; M-1 como K. pneumoniae y M8-3 como E. cloacae; y por PCR fueron identificados como S. maltophilia.

Solo tres aislamientos coincidieron en la identificación molecular y la bioquímica, debido probablemente a que la segunda no es una herramienta lo suficientemente específica para este fin; mientras que las técnicas moleculares permiten la caracterización de los microorganismos para lograr su determinación a nivel interespecífico o intraespecífico (Bou et al., 2011). Los individuos de una misma especie no necesariamente tienen los mismos atributos genéticos, bioquímicos y toxicológicos. Por otro lado, especies diferentes pueden mostrar una alta similitud genética, bioquímica y toxicológica. La clasificación mediante medios selectivos y pruebas bioquímicas posibilita la identificación hasta género y, en ocasiones, hasta especie. En cambio, las técnicas moleculares permiten caracterizar subespecies, serovariedades y cepas de una forma más simple, rápida y reproducible en una gran variedad de microorganismos (Godoy et al., 2008).

Efecto biofertilizante. Los tratamientos que presentaron mejores resultados en la emergencia de las plantas, el diámetro del tallo y la longitud de las hojas y los tallos fueron M8-10, M10-1 y M11-3, identificados como S. maltophilia por PCR (tabla). Estos tuvieron diferencias significativas con respecto al testigo y a la fertilización química, además se observó una mayor eficiencia en la emergencia y el crecimiento en las plantas de maíz. El tratamiento con M10-1 mostró una mayor eficiencia en el desarrollo de la planta, lo que promovió una rápida emergencia y un mayor tamaño en el diámetro del tallo y en la longitud de las raíces y los tallos, así como un mayor peso seco (fig. 2). De acuerdo con el análisis estadístico de los datos de emergencia y crecimiento de las plantas, M10-1 presentó valores por encima de la media y límite superior, con respecto a los otros aislados y controles (tabla). Es importante destacar que el resto de los aislados tuvo resultados adecuados, sin diferencias significativas con respecto a M10-1, por lo cual se convierten en potenciales biofertilizantes.

El efecto beneficioso de las rizobacterias radica en diferentes mecanismos, tales como: la producción de sustancias estimuladoras del crecimiento, sideróforos y antibióticos; así como la inducción de resistencia en la planta y la fijación del nitrógeno (Torriente, 2010). Por ello el aislamiento de bacterias diazótrofas, su identificación mediante métodos confiables y la evaluación de su capacidad como promotoras del crecimiento vegetal, además de ser una opción en procesos investigativos con fines agrícolas, es una buena alternativa para mejorar la nutrición y la calidad de los cultivos, lo que contribuye al mejoramiento del sistema planta-suelo-microorganismo.

Se concluye que los resultados obtenidos mediante técnicas convencionales suelen ser poco fiables y provocan errores en el momento de definir el género y la especie de un microorganismo del suelo. Además, el ensayo que se aplicó para la evaluación de la capacidad de algunos aislados respecto a la promoción del crecimiento vegetal permitió evidenciarlos como potenciales biofertilizantes; ello se comprobará en un estudio a nivel de invernadero, con un suelo no estéril, para compararlo con los microorganismos nativos y condiciones controladas, con posibilidades de ser aplicados en campo en cultivos de interés agronómico.

 

REFERENCIAS BIBLIOGRÁFICAS

1. Bou, G. et al. 2011. Métodos de identificación bacteriana en el laboratorio de microbiología. Enferm. Infecc. Microbiol. Clin. 29 (8):601.

2. Bruinsma, Jelle (Ed.). 2003. World agriculture: Towards 2015/2030 an FAO perspective. FAO, Rome. 432 p.

3. Bürgmann, H.; Widmer, F.; Sigler, W.V. & Zeyer, J. 2003. mRNA extraction and reverse transcription-PCR Protocol for detection of nifH gene expression by Azotobacter vinelandii in Soil. Appl. Environm. Microbiol. 69 (4):1928.

4. Carvajal, J. & Mera, A.C. 2010. Fertilización biológica: técnicas de vanguardia para el desarrollo agrícola sostenible. Producción + Limpia. 5 (2):77.

5. Cline, M.G. 1944. Principles of soil sampling. Soil Science. 58:275.

6. Godoy, M. et al. 2008. Identificación de micobacterias no tuberculosas: comparación de métodos bioquímicos y moleculares. Revista de la Sociedad Venezolana de Microbiología. 28:96

7. Kisková, J. et al. 2012. Bacterial prevalence in the Dunnock (Prunella modularis) in sub-alpine habitats of the Western Carpathians, Slovak Republic. Ornis Fennica. 89 (1):34

8. Levy-Booth, D.J. & Winder, R.S. 2010. Quantification of nitrogen reductase and nitrite reductase Genes in soil of thinned and clear-cut douglas-fir stands by using real-time PCR. Appl. Environm. Microbiol. 76 (21):7116

9. Olarte, R.L. et al. 1979. Métodos analíticos del laboratorio de suelos. 4a. ed. Instituto Geográfico Agustín Codazzi, Bogotá. 613 p .

10. Rashamuse, K.J.; Burton, S.G. & Cowan, D.A. 2007. A novel recombinant ethyl ferulate esterase from Burkholderia multivorans. J. Appl. Microbiol. 103:1610.

11. Sosa, A. 2002. Muestreo de suelos. Instituto Nacional de Tecnología Agropecuaria, Buenos Aires.

12. Torriente, D. 2010. Aplicación de bacterias promotoras del crecimiento vegetal en el cultivo de la caña de azúcar. Perspectivas de su uso en Cuba. Cultivos Tropicales. 31 (1):19.

13. Utria-Borges, E. et al. 2008. Utilización agraria de los biosólidos y su influencia en el crecimiento de plántulas de tomate (Lycopersicon esculentum Mill.). Revista Chapingo. Serie horticultura. 14 (1):33.

14. Whitby, P. et al. 2000. Identification and detection of Stenotrophomonas maltophilia by rRNA- directed PCR. J. Clin. Microbiol. 38 (12):4305.

 

 

 

Recibido el 10 de febrero del 2012
Aceptado el 22 de diciembre del 2012